Skip to main content

Advertisement

Table 1 Primers used in this study

From: Crystal structure of carbonic anhydrase CaNce103p from the pathogenic yeast Candida albicans

Construct Primer name Sequence Restriction site
WT WT_CaNCE103 Nde I F AAGGAGATATACATATGATGGGTAGAGAAAATATTTTGAA NdeI
Δ29/Δ48/Δ61_CaNCE103 Xho I R GGTGGTGGTGCTCGAGTCAATGAGGGTTATATTCTTCTTC XhoI
Δ29 Δ29_CaNCE103 Nde I F AAGGAGATATACATATGGATAATAATAACAACCTAAACGG NdeI
Δ29/Δ48/Δ61_CaNCE103 Xho I R GGTGGTGGTGCTCGAGTCAATGAGGGTTATATTCTTCTTC XhoI
Δ48 Δ48_CaNCE103 Nde I F AAGGAGATATACATATGGTTAGTTCAGGAAATCATAATAAT NdeI
Δ29/Δ48/Δ61_CaNCE103 Xho I R GGTGGTGGTGCTCGAGTCAATGAGGGTTATATTCTTCTTC XhoI
Δ61 Δ61_CaNCE103 Nde I F AAGGAGATATACATATGTCTTCAGAATCTACATTACAAGATTT NdeI
Δ29/Δ48/Δ61_CaNCE103 Xho I R GGTGGTGGTGCTCGAGTCAATGAGGGTTATATTCTTCTTC XhoI