Skip to main content

Table 1 Expression constructs for human ZHXs

From: Novel structural features in two ZHX homeodomains derived from a systematic study of single and multiple domains

Protein Construct OPPF_ Domain/s aa range 5' primer 3' primer Vector Tag
ZHX1 1610 Full-length 1-874 ATGGCAAGCAGGCGAAAATCAAC TCAGTCATCTGATTTAGACAGCTTCCG pDEST14 N-His
  1611 HD1 284-343 AATAGCATTCCCACCTACAATGCTGC CCAACTAACACCATGTTTTAAACGTTGGGC pDEST14 N-His
  1612 HD3 556-633 CAGCCTAAGCAATCCTGGAATCC ATCTATTTCCATTTTCTCTTCCTTTAAAGCTTTTG pDEST14 N-His
  1613 HD4 655-731 GCACCTAAGTCAGGGAGTACAGGCAAG TGAATTGGCGCTCTGATAGTAGTAGTACCATTTC pDEST14 N-His
  1614 HD5 770-824 GACAGGGGACCATCACTCATAAAATTTAAAAC TCTTCTCTGTCTTTCTGCAAACCACTCTCTG pDEST14 N-His
  1615 HD3-4 556-731 CAGCCTAAGCAATCCTGGAATCC TGAATTGGCGCTCTGATAGTAGTAGTACCATTTC pDEST14 N-His
  1616 HD1-5 284-824 AATAGCATTCCCACCTACAATGCTGC TCTTCTCTGTCTTTCTGCAAACCACTCTCTG pDEST14 N-His
  1632 2ZF 60-153 AATCAGCAAAATAAAAAAGTTGAAGG AAAAGTCAGATCATTTATTGTTTGTTC pDEST14 N-His
  1633 2ZF 55-156 TCTGTGGATTCAGACAATCAGC ACTACCATCAAAAGTCAGATCATTTATTG pDEST14 N-His
  1634 HD2 464-523 TCATTTGGCATTCGGGCAAAAAAGAC CTTTGAATTTCTCTGGTTGTACCTTGTG pDEST14 N-His
  1635 HD2-3 464-633 TCATTTGGCATTCGGGCAAAAAAGAC ATCTATTTCCATTTTCTCTTCCTTTAAAGCTTTTG pDEST14 N-His
  1636 HD2-4 464-731 TCATTTGGCATTCGGGCAAAAAAGAC TGAATTGGCGCTCTGATAGTAGTAGTACC pDEST14 N-His
  1637 HD2-5 464-824 TCATTTGGCATTCGGGCAAAAAAGAC TCTTCTCTGTCTTTCTGCAAACCACTCTCTG pDEST14 N-His
  2264 HD3 556-633 CAGCCTAAGCAATCCTGGAATCC ATCTATTTCCATTTTCTCTTCCTTTAAAGCTTTTG pOPINF N-His -3C
  2265 HD4 655-731 TCTGTGGATTCAGACAATCAGC TTCTATACCTAATTCTGATCTTCTCTGTC pOPINF N-His -3C
  2465 All 55-830 TCTGTGGATTCAGACAATCAGC TTCTATACCTAATTCTGATCTTCTCTGTC pOPINF N-His -3C
ZHX2 2268 2ZF 60-158 GTGATAGAGGTGAAATCTATGGG GGTTTCGATGGACTGTTCCAAG pDEST14 N-His
  2269 HD1 267-321 TACAACTCTGCCCTGGATACAA CCAGCTGATGCCATGCTTTAAG pDEST14 N-His
  2270 HD2 444-500 CGCAAGAAGACAAAGGAGCAG GTGGACGATGCCCCTTTGAC pDEST14 N-His
  2271 HD3 530-582 CCCCAGAAGTTCAAAGAGAAAAC CTTCCGCCTCTCCGAGAACC pDEST14 N-His
  2272 HD4 635-686 AAAAGTCAAGAACAGGTTCATCTC TCCCGTTTTCAGCAAGCATCTG pDEST14 N-His
  2273 HD2-3 444-582 CGCAAGAAGACAAAGGAGCAGA CTTCCGCCTCTCCGAGAACC pDEST14 N-His
  2466 All 55-745 TCCAAAGAAAACGAAGTGATAGAGGTGAAATC CAACTTCTCCAAGTCCTCTTCGCAG pOPINF N-His -3C
ZHX3 2274 2ZF 66-153 AATGGGCATCGGAGCACTTTAG CTGCTCCACAACCACATGATTG pDEST14 N-His
  2275 HD1 306-363 ATTCCAACGTACAATGCAGCC CCAGCTGATCCCCTGCTTCAG pDEST14 N-His
  2276 HD2 500-553 AAGAAATCTCATGAACAGCTGTCAG CTTCAAGTTCCGGCAGTGGTATC pDEST14 N-His
  2277 HD3 621-664 CCTGAGCAGCTCAGAGCC CCGTCTCTCTGAAAACCAGC pDEST14 N-His
  2278 HD4 758-826 AAACTGGCAGAGCAGCTCC CCATTTGAGTTGGCCGTTCTTC pDEST14 N-His
  2279 HD2-3 500-664 AAGAAATCTCATGAACAGCTGTCAG CCGTCTCTCTGAAAACCAGC pDEST14 N-His
  2467 All 61-966 GGCTCTACACTGGCCAATGGGC AGGTAAAGGAAAGGTCCTACATTGTGGG pOPINF N-His -3C
  1. For the primers only the regions homologous to the target sequence are shown. 5' primers had GGGGACAAGTTTGTAC
  2. CCAAAAAAGCAGGCTTCGAAGGAGATAGAACCATGGCACATCACCACCACCATCAC and AAGTTCTGTTTCAGGGCCCG 5' extensions, while 3' primers had GGGG
  3. ACCACTTTGTACAAGAAAGCTGGGTCTCA and ATGGTCTAGAAAGCTTTA 5' extensions for cloning into pDEST14 or pOPINF vectors using either Gateway technology or the Infusion cloning system respectively.