Skip to main content

Table 4 Nucleotide sequences of used primers

From: Molecular analysis of hyperthermophilic endoglucanase Cel12B from Thermotoga maritima and the properties of its functional residues

Primers Nucleotide sequence
Forward 1 5'-AGTAGATNNN TGGATATCCATGCACCCAGC -3'
Reverse 1 5'-ACGGTTACAAGCCCTGGGCG -3'
Forward 2 5'- CATGGATATAAG GAGATCTACTACGGTTACAAG -3′
Reverse 2 5'-CACCCAGCTGTCTGGATTCTGAAG -3'
Forward 3 5'-GAATTTCTTAAG CTGAAGGTGAAAGATCTTCC -3'
Reverse 3 5'-AACACCGCTGTTGTGCCCCG -3'
Forward 4 5'-CGGAGATCTGG GTTTGGTTCTACAACAACGTTC-3'
Reverse 4 5'-CGTCACCCGAAGAAACAGAGGTC -3'