Skip to main content

Table 1 Primers used in this study

From: Prokaryotic ubiquitin-like protein remains intrinsically disordered when covalently attached to proteasomal target proteins

Constructs/Variants Primer Nr Sequence of PCR primer (5'-3', restriction sites: italic, mutations/insertions: underlined)
His6-TEV-PanB fwd P1 ATTAGTTATCTTAAGATGTCGGAGCAGACTATCTAT
His6-TEV-PanB rev P2 AATTTATATCCTAGGTTAGAAACTGTGTTCGTCAGC
PanB-K212A fwd P3 CCCAGATCACCGGCGCGCTTACCATTCCGACGG
PanB-K212A rev P4 TGGCCAACTCGGCGGGCACCATCTCCATCACGAC
His6-TEV-FabD fwd P5 GAGATATACATATGCACCATCACCATCACCATGGCGAGAATCTTTATTTTCAGGGCATGATTGCGTTGCTGGCACCC
His6-TEV-FabD rev P6 ATATTATCCTAGGTTATAGGTTTGCCAGCTCGTCCAGGT
His6-TEV-GG-FabD fwd P7 ATGATTGCGTTGCTGGCACCCGGA
His6-TEV-GG-FabD rev P8 ACCGCCGCCCTGAAAATAAAGATTCTCGCC
FabD-K35R fwd P9 GATCTTGCCCGGCTGGGCACCACC
FabD-K35R rev P10 TAGATCAGCGGCACGCGACCACGC
FabD-K122R fwd P11 CGCGGCGCCGAGATGGCCCGCGCCTGCGCCACCGAGCCG
FabD-K122R rev P12 CGGCTCGGTGGCGCAGGCGCGGGCCATCTCGGCGCCGCG
FabD-K181R fwd P13 GACCCGCCGGCCCGCGCGCGGGTGCGT
FabD-K181R rev P14 TTCGGCGAGCTTCTCCAACGCGGTCAG